![subject](/tpl/images/cats/biologiya.png)
Biology, 20.07.2019 08:00 Serenitybella
All the offspring of a cross between a black-eyed mendelian and an orange-eyed mendelian have black eyes. what is the expected phenotypic ratio of a cross between two orange-eyed mendelian? a.3 black-eyed: 1 orange-eyed b.0 black-eyed: 1 orange-eyed c.1 black-eyed: 3 orange-eyed d.1 black-eyed: 0 orange-eyed
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 08:00
Which best example best demonstrates the importance of having knowledge of evolutionary relationships? a. illustration of a plant b.organ transplantation between species c. blood donation from a human d. do you need sequence of an insect.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 10:30
Which label correctly identifies what x represents in the concept map?
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:30
In meiosis ii during anaphase ii which structures separated homologous chromosomes or sister chromatids
Answers: 1
You know the right answer?
All the offspring of a cross between a black-eyed mendelian and an orange-eyed mendelian have black...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 29.11.2020 03:10
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 29.11.2020 03:10
![question](/tpl/images/cats/istoriya.png)
History, 29.11.2020 03:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 29.11.2020 03:10
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 29.11.2020 03:10
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 29.11.2020 03:10
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 29.11.2020 03:10
![question](/tpl/images/cats/ap.png)
Advanced Placement (AP), 29.11.2020 03:10
![question](/tpl/images/cats/mkx.png)
Arts, 29.11.2020 03:10
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 29.11.2020 03:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 29.11.2020 03:10