![subject](/tpl/images/cats/biologiya.png)
Biology, 16.07.2019 06:30 fymdes2001
What shows the movement of energy (in the form of food) from one organism to another?
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 00:30
Building glycogen from glucose molecules is an example of what
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:00
Identify the terms using the following picture. principle of dominance item 1 can be described as the . item 2 can be described as the . the "p" represents from one parent.
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 20:30
Which type of mutation occurs in reproductive cells and can be passed to offspring? somatic mutation germline mutation point mutation frameshift mutation
Answers: 1
You know the right answer?
What shows the movement of energy (in the form of food) from one organism to another?...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/User.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 05.05.2021 22:40
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 05.05.2021 22:40
![question](/tpl/images/cats/mat.png)
Mathematics, 05.05.2021 22:40
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 05.05.2021 22:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 05.05.2021 22:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 05.05.2021 22:40
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 05.05.2021 22:40
![question](/tpl/images/cats/mat.png)
Mathematics, 05.05.2021 22:40
![question](/tpl/images/cats/himiya.png)
Chemistry, 05.05.2021 22:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 05.05.2021 22:40
![question](/tpl/images/cats/mat.png)
Mathematics, 05.05.2021 22:40