subject
Biology, 15.07.2019 05:00 winterrs12

James is making models of plant and animal cells using objects supplied by his teacher to represent organelles. for one cell, he will place the objects in a shoebox. first he fills a balloon with water and places it in the shoe box. he also drops a handful of marbles into the box. which statement most likely describes the structures he has represented so far? he is making an animal cell. the box is the cell membrane, and the balloon represents the large vacuole. the marbles are the endoplasmic reticulum. he is making a plant cell. the box is the cell wall, and the balloon represents the large vacuole. the marbles are the tiny ribosomes. he is making a plant cell. the box is the cell wall, and the balloon represents the nucleus. the marbles are the centrioles. he could be making either a plant or animal cell. the box is the cell wall, and the balloon represents the large vacuole. the marbles are the centrioles.

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 00:30
The location of the stomach is the diaprham
Answers: 1
question
Biology, 22.06.2019 06:20
What makes a dominant allele different from a recessive allele
Answers: 2
question
Biology, 22.06.2019 07:00
In 2001, records showed that local stocks of fish were down worldwide. yet, records of harvests indicated that fish were being taken at records rates. what was actually happening?
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
James is making models of plant and animal cells using objects supplied by his teacher to represent...
Questions
Questions on the website: 13722362