subject
Biology, 14.07.2019 06:00 kskfbfjfk

Apoint mutation changes the dna sequence cgatocgt, but the same protein is produced. what point mutation occured?

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 06:30
1. describe the structure and function of the specialized cells you observed in the video. 2. research the types of cells present in the kidney.
Answers: 1
question
Biology, 22.06.2019 10:30
Which of the following words best matches this definition: the process in which the best adapted organisms survive and pass on their traits, while those that are not well adapted do not survive to pass on their traits. question 3 options: acquired selection natural selection artificial selection organic selection
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:30
Fill in the blank with the best word to complete the sentence. white blood cells protect against and aid in blood clotting when injuries are sustained.
Answers: 2
You know the right answer?
Apoint mutation changes the dna sequence cgatocgt, but the same protein is produced. what point muta...
Questions
question
Computers and Technology, 07.10.2021 14:50
question
Mathematics, 07.10.2021 14:50
question
Social Studies, 07.10.2021 14:50
Questions on the website: 13722363