Biology, 12.07.2019 14:30 nicoleskertich
1. energy from the sun drives wind movements on earth. 2. frequent changes in temperature can cause cracks to form in rock formations. 3. changes in species can be seen in fossils trapped in sedimentary rock. 4. earth’s oceans absorb much of the energy received from the sun. a. oceanography b. meteorology c. geology d. biology e. astronomy
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:10
What mistake did john needham make that caused him to conclude that spontaneous generation for microorganisms occurred? a. he re-contaminated his boiled broth solutions. b. he destroyed the vital force in the solutions. c. he did not boil his broth solutions, only warmed them. d. he failed to seal his flasks of boiled broth. e. he allowed his assistant to conduct the experiment which he did not monitor closely.
Answers: 2
Biology, 22.06.2019 12:30
Which of the following matches the organisms described with the correct domain? a. archaea--multicellular, eukaryotic organisms that do not have cell walls b. eukarya--single-celled and multicellular organisms, with a defined nucleus and a variety of nutritional sources c. bacteria--unicellular, eukaryotic organisms with cell walls that do not contain peptidoglycan d. bacteria--unicellular, eukaryotic organisms that always lack cell walls
Answers: 3
Biology, 23.06.2019 01:50
What is expressed when both alleles for a gene are equally expressed as in human blood type?
Answers: 1
1. energy from the sun drives wind movements on earth. 2. frequent changes in temperature can cause...
Physics, 16.10.2019 08:50
Mathematics, 16.10.2019 08:50
Biology, 16.10.2019 08:50
Biology, 16.10.2019 08:50
Social Studies, 16.10.2019 08:50
Mathematics, 16.10.2019 08:50
Health, 16.10.2019 08:50
Geography, 16.10.2019 08:50
Chemistry, 16.10.2019 08:50