![subject](/tpl/images/cats/biologiya.png)
Biology, 10.07.2019 05:30 missheyward30
Culture of klebsiella colonies is smooth, indicating the presence of a capsule. a culture of pseudomonas shows rough colonies. based on this information alone, which species is likely to be more pathogenic?
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 13:00
Explain the importance of producers, primary consumers, secondary consumers and decomposers in an ecosystem.
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:30
Describe your dna model. which part do the straws represent? the pushpins? the paper clips and the black dots you made with the marker?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 22:30
The greatest increses in energy use occuree between which two stafes of society
Answers: 1
You know the right answer?
Culture of klebsiella colonies is smooth, indicating the presence of a capsule. a culture of pseudom...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 21.07.2020 22:01
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 21.07.2020 22:01
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 21.07.2020 22:01
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 21.07.2020 22:01