5’atgcccgggtgtcgtagttga3’ complete the complementary sequence for theme template strand above. what would the mrna be based upon the template strand above? mrna what would the primary linear structure of the protein be based upon the mrna strand above?due tonight.

The table shows dates and appearance of index fossils. which rock layers can be dated most precisely? a) a layer containing both a fossil 4 and a fossil 3 b) a layer containing both a fossil 2 and a fossil 3 c) a layer containing both a fossil 1 and a fossil 4 d) a layer containing both a fossil 1 and a fossil 2

Which statement best compares aerobic and anaerobic respiration

How and why organisms are hierarchically classifies