What is the dna compliment to the given strand tacgtatgccgtatgggcatt

An organ system consists of a group of organs that performs specific functions necessary for the survival of an organism. humans have eleven different organ systems: integumentary, skeletal, muscular, nervous, endocrine, circulatory, lymphatic, respiratory, digestive, urinary, and reproductive. discuss the function of neurons, the brain and the spinal cord within the human nervous system while explaining the interrelationship of each organ.

Imagine you are introducing the lac operan and the trp operon to students who have never learned about it before. complete the table to compare the similarities and differences between the two operons

Cells are adapted to preform specific functions. which of the following terms refers to this capability?