Will give brainliest for good answer

give me a a constructed and revised explanation based on evidence for how carbon, hydrogen, and oxygen form sugar molecules may combine with other elements to form animo acids and/or other large carbon based molecules

16. which of the following accurately describes a step within transcription? a. dna polymerase uses one strand of rna as a template to put together nucleotides. b. the dna strand is used as a template for which a complementary rna strand can be produced. c. the rna strand forms a template by which dna can be built. d. the rna strand is produced within the cytoplasm.

The eruption of a nearby volcano causes a prairie ecosystem to receive a lot less sunlight. which of these is most likely effect on the ecosystem?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?