The products of combustion include
a. oxygen
b. energy
c. water
d. bo...
![subject](/tpl/images/cats/biologiya.png)
Biology, 03.02.2020 18:47 daemonacoster
The products of combustion include
a. oxygen
b. energy
c. water
d. both a & b
![ansver](/tpl/images/cats/User.png)
Answers: 2
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 01:50
Four different thermometers were used to measure the temperature of a sample of pure boiling water. the measurements are recorded in the table below. thermometer temperature reading 1 temperature reading 2 temperature reading 3 w 100.1°c 99.9°c 96.9°c x 100.4°c 102.3°c 101.4°c y 90.0°c 95.2°c 98.6°c z 90.8°c 90.6°c 90.7°c the actual boiling point of pure water is 100.0°c. what can be concluded from the data about the reliability and validity of the thermometers?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:00
Will mark you as ! keiko’s teacher was discussing the theory of endosymbiosis. she asked keiko to mark the organelles in the diagram that most closely resembled prokaryotes. which organelles should keiko mark? * the first image is the question and the second image is some information to you answer the !
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:10
Explain the cellular functions that occur when antibiotics attack a bacteria cell. a. antibiotics target the cell wall, cell membrane, and the processes of protein and nucleic acids production in bacteria to rupture the cell. b. antibiotics create dormant resistant endospores to preserve the genetic material and rupture the cell. c. antibiotics target the cell wall and form a bridge-like connection to form conjugation. d. antibiotics use binary fission to grow twice its size, replications its dna, and split into two cells.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Questions
![question](/tpl/images/cats/en.png)
English, 15.07.2019 14:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
History, 15.07.2019 14:00
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/fizika.png)
Physics, 15.07.2019 14:00
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 15.07.2019 14:00
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/en.png)
English, 15.07.2019 14:00
![question](/tpl/images/cats/mat.png)
Mathematics, 15.07.2019 14:00
![question](/tpl/images/cats/mat.png)
Mathematics, 15.07.2019 14:00
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 15.07.2019 14:00
![question](/tpl/images/cats/mat.png)