subject
Biology, 25.06.2019 17:00 borsha255

This type of reproduction produces a new cell or organism that is an exact genetic copy of its parent:

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:00
The (blank) states that all loving things are made of cells.
Answers: 1
question
Biology, 22.06.2019 22:00
Earth is tilted on its axis. which of these would not exist if earth had no tilt?
Answers: 2
question
Biology, 23.06.2019 01:30
During which phase does the dna make a copy of itself?
Answers: 1
You know the right answer?
This type of reproduction produces a new cell or organism that is an exact genetic copy of its paren...
Questions
question
Mathematics, 29.01.2021 18:00
question
Mathematics, 29.01.2021 18:00
question
English, 29.01.2021 18:00
question
Arts, 29.01.2021 18:00
question
Mathematics, 29.01.2021 18:00
question
Mathematics, 29.01.2021 18:00
Questions on the website: 13722361