Cant get wrong , its like a work bank but dont know what its called.
in any family, the...
Cant get wrong , its like a work bank but dont know what its called.
in any family, the children may or may not look like their parents. they may or may not look like their siblings. that's because each one of us inherit half of our chromosomes from our mother and half from our father. what assortment of we get varies from child to child. our chromosomes contain many genes, and each gene codes for a specific trait. the traits people see, like eye color hair color, or height, also depend on whether the gene is dominant or recessive. in this family, brown hair is dominant over red hair. it is very possible that these two parents could only have children with brown hair! it is also possible that their children all have red hair! why? first, to inherit a recessive trait like red hair, you must have two genes for red hair color. because one parent, the mother, has red hair we know the mother must have two genes for red hair. the father has brown hair. we know he must have at least one gene for brown hair but he also has one gene for red hair. what two genes will their children have? it's a matter of probability. each child has a 100% chance of inheriting the red hair gene from their mother and a 50% chance of inheriting the red hair gene from dad. that means, all the children will have at least one gene for red hair!
1.where do our chromosomes come from? (twelve word phrase)
2.what codes for each specific trait? (one word)
3.in this family, what is the dominant hair color? (two words)
4.in this family, each child has a chance of inheriting one gene for red hair. (percentage)
5.what combination of genes you receive from your parents is a matter of (one word)
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 16:00
Which of these outcomes is a negative impact of postindustrial societies on the environment? a. nomadic ways b. overpopulation c. overgrazing d. resource renewal
Answers: 3
Biology, 23.06.2019 00:30
Imagine that you are a doctor in a maternity ward. during your last shift, 20 babies were born. 10 had blue eyes, and 10 had brown eyes. 15 had round heads, and 5 had pointed heads. what are the parents phenotypes/traits?
Answers: 2
Mathematics, 07.12.2020 19:20
Mathematics, 07.12.2020 19:20
Mathematics, 07.12.2020 19:20
Mathematics, 07.12.2020 19:20
Mathematics, 07.12.2020 19:20
Mathematics, 07.12.2020 19:20
Law, 07.12.2020 19:20
Mathematics, 07.12.2020 19:20
Chemistry, 07.12.2020 19:20
History, 07.12.2020 19:20
Social Studies, 07.12.2020 19:20
Mathematics, 07.12.2020 19:20