Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 17:30
The diagram shows the results when two parents are crossed. the letters represent alleles for a trait that is controlled by three different genes. which best describes this inheritance pattern? multiple allele because a trait is controlled by three different genes polygenic because the offspring have alleles from both parents multiple allele because the offspring have alleles from both parents polygenic because a trait is controlled by three different genes
Answers: 1
Biology, 22.06.2019 20:00
What determines whether a particular cell is able to respond to a hormone?
Answers: 3
Biology, 22.06.2019 21:00
What is the type of asexual reproduction represented inside the box ? answer this
Answers: 3
Because a client diagnosed with pernicious anemia is extremely fearful of the monthly im injections...
Mathematics, 18.07.2019 07:00
Mathematics, 18.07.2019 07:00
Mathematics, 18.07.2019 07:00
History, 18.07.2019 07:00
English, 18.07.2019 07:00
Mathematics, 18.07.2019 07:00
Biology, 18.07.2019 07:00
Chemistry, 18.07.2019 07:00
History, 18.07.2019 07:00
Mathematics, 18.07.2019 07:00