subject
Biology, 01.08.2019 23:20 TheChosenOne9050

Which term refers to the tearing of ligaments surrounding a joint?
a. cramp
b. spasm
c. sprain
d. strain

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 06:00
Most animal cell membranes have proteins that pump. ions out of the cell and potassium ions into this
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:30
This is collection of data made by comparing objects in standard units. in science, the units are metric.
Answers: 3
question
Biology, 22.06.2019 16:00
In sheep, the allele for belly fur (a) is dominant to the allele for no belly fur (a). a mother with the genotype aa and a father with the genotype aa produce an offspring.
Answers: 1
You know the right answer?
Which term refers to the tearing of ligaments surrounding a joint?
a. cramp
b. spasm
Questions
question
Physics, 17.09.2019 03:30
question
Mathematics, 17.09.2019 03:30
question
Chemistry, 17.09.2019 03:30
question
Mathematics, 17.09.2019 03:30
Questions on the website: 13722363