subject
Biology, 13.08.2019 03:20 kamjay2006

16 kb linear dna is cut with ecori and bamhi restriction enzymes. the ecori digest yields fragments of 2 kb, 6 kb, and 8 kb. the bamhi digest yields fragments of 5 kb and 11 kb. an ecori/bamhi double digest yields 2 kb, 3 kb, 5 kb and 6 kb fragments. what is the final restriction digest map of the two enzymes, and the fragments they create? (e=ecori cut, b=bamhi cut)

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 04:00
The tubes transporting minerals and water upward are called ?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 16:00
Where is having brightly colored feathers that attract mates most clearly an adaptation for a bird? a. a forest with dense vegetation b. a sandy beach beside an ocean c. a snowy tundra with little vegetation d. a swamp with many hawks that eat birds
Answers: 1
question
Biology, 22.06.2019 16:00
Draw a simple labelled diagram if a collenchyma tissue
Answers: 2
You know the right answer?
16 kb linear dna is cut with ecori and bamhi restriction enzymes. the ecori digest yields fragments...
Questions
question
Physics, 29.07.2019 22:30
question
Mathematics, 29.07.2019 22:30
question
Biology, 29.07.2019 22:30
question
Biology, 29.07.2019 22:30
Questions on the website: 13722363