Biology, 20.09.2019 18:10 Islandgirl67
Why might buying a more expensive product made of recycled materials be a smarter purchase in the long run?
a. there is not a market for recycled materials
b. recycled materials are often more expensive but they save recourses such as trees or minerals
c. recycled materials do not prevent pollution created by manufacturing new materials
d. recycled materials do not save landfill space because they are still thrown away
Answers: 1
Biology, 21.06.2019 23:40
When coal has reached it hardest, darkest form, it is called select one: 0 a. sub-bituminous b. lignite c. bituminous d. antrhacite next page
Answers: 3
Biology, 22.06.2019 08:00
Cattle with brown fur and cattle with white fur will produce a reddish roan calf . when examined closely, the calf show about an even number of brown hairs and white hairs that give a reddish appearance when viewed from far away. the fact that both the brown fur allele and the white fur allele are expressed equally in the offspring is an example of
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Why might buying a more expensive product made of recycled materials be a smarter purchase in the lo...
Social Studies, 29.03.2020 20:46
Mathematics, 29.03.2020 20:46
Chemistry, 29.03.2020 20:46
Mathematics, 29.03.2020 20:46
Biology, 29.03.2020 20:46
Mathematics, 29.03.2020 20:47
Mathematics, 29.03.2020 20:47
Mathematics, 29.03.2020 20:47