subject
Biology, 21.09.2019 00:30 alanflores40

Suggest one advantage that electrophoresis has over chromatography. a. electrophoresis separates molecules based on differences in chemical properties, thereby making it possible to separate molecules that undergo similar chemical reactions. b. electrophoresis separates molecules based on charge differences, thereby making it possible to separate molecules that are similar in size, shape, and density. c. electrophoresis separates molecules based on differences in solubility, thereby making it possible to separate molecules that are similar in mass and size. d. electrophoresis separates molecules based on mass differences, thereby making it possible to separate molecules that are similar in molar mass.

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 10:00
1. fold your hands together so your thumbs cross over ,and look at your thumbs. which thumb feels most "comfortable" on top is actually controlled by a gene. the left thumb folding over the right thumb is a domi
Answers: 3
question
Biology, 22.06.2019 10:30
Nkentucky, intoxicating beverages (beer, whiskey, wine, etc.) are involved to some extent in approximately % of collisions fatal to pedestrians.
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:00
The most famous fossil called archaeopteryx is which of the following? a dinosaur a fern a fish a bird
Answers: 2
You know the right answer?
Suggest one advantage that electrophoresis has over chromatography. a. electrophoresis separates mol...
Questions
question
Mathematics, 18.10.2019 01:30
question
Physics, 18.10.2019 01:30
question
History, 18.10.2019 01:30
Questions on the website: 13722367