Biology, 11.10.2019 17:20 graymonky12
Which of the following types of models would be most effective to demonstrate the relationship between distance and time?
a.
idea model
physical model
c. computer model
d. none of the above
b.
select the best answer from the choices provided
Answers: 3
Biology, 21.06.2019 19:30
Color blindness is a recessive trait. the gene for color blindness is on the x chromosome. the family tree below shows the trait of color blindness. the only unknown is the mother in the first generation
Answers: 1
Biology, 21.06.2019 23:50
Which statement about the immune system is false? a. lymphocytes reduce inflammation, b. b cells remember specific pathogens. c. most white blood cells kill bacteria d. white blood cells are made in lymph nodes.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:00
Refer to the family pedigree shown here. in generation i, one parent is affected by the gene mutation and one parent isn't. in generation ii, all three children are affected by the gene mutation. what can you conclude about this gene mutation? a. all children born in future generations will be affected by this disorder. b. this gene mutation is a dominant disorder. c. this gene mutation is a recessive disorder. d. the generation i mother is a carrier of this gene mutation.
Answers: 2
Which of the following types of models would be most effective to demonstrate the relationship betwe...
Mathematics, 03.11.2020 19:50
Mathematics, 03.11.2020 19:50
Mathematics, 03.11.2020 19:50
English, 03.11.2020 19:50
Mathematics, 03.11.2020 19:50
Chemistry, 03.11.2020 19:50
Mathematics, 03.11.2020 19:50
Health, 03.11.2020 19:50
Geography, 03.11.2020 19:50
Spanish, 03.11.2020 19:50