Dna replication, transcription, & translation (10 points)
1. provide the (a) dna strand a...
Dna replication, transcription, & translation (10 points)
1. provide the (a) dna strand and (b) mrna strand that would be produce from the
following dna template: gctaccgactcgactgcactt
a. dna strand:
b. mrna strand:
2. what enzyme(s) is adding nucleotides to the template dna strand during (a) dna replication
and (b) transcription
a. dna replication:
b. transcription:
3. use the mrna strand from question 1 to translate into a series of proteins. use the
codon chart attached and fill out the chart below.
Answers: 1
Biology, 21.06.2019 17:00
Are produced in the light reactions and used in the calvin cycle. a)nadh and atp b)electrons and sugar c)nadt+ and adp d)sugar molecules
Answers: 1
Biology, 22.06.2019 04:20
When in solution, a molecule that moves slowly across an artificial membrane moves rapidly across a plasma membrane. this molecule rapidly enters the cell regardless of whether its concentration is higher inside or outside the cell. using this information, which transport mechanism is most likely to be responsible for the movement of the molecule across a plasma membrane? view available hint(s)when in solution, a molecule that moves slowly across an artificial membrane moves rapidly across a plasma membrane. this molecule rapidly enters the cell regardless of whether its concentration is higher inside or outside the cell. using this information, which transport mechanism is most likely to be responsible for the movement of the molecule across a plasma membrane? active transportexocytosis
Answers: 2
Biology, 22.06.2019 04:30
Anurse is in the dining room and overhears a new nurse tell a client with body dysmorphic disorder that she's much too thin and must eat more before she can go home. the client bursts into tears and runs out of the dining room. what is the best way for the nurse to address this situation?
Answers: 1
Mathematics, 02.04.2021 20:50
History, 02.04.2021 20:50
Mathematics, 02.04.2021 20:50
Health, 02.04.2021 21:00
History, 02.04.2021 21:00
Computers and Technology, 02.04.2021 21:00
Mathematics, 02.04.2021 21:00