Consider the following mrna strand: ccauggcaaaggagugacuaa
a. what dna sequence would encode...
Consider the following mrna strand: ccauggcaaaggagugacuaa
a. what dna sequence would encode for this mrna? provide the sequence in form (single-or doublestranded) in which it would predominantly appear in the cell. label the termini.
b. draw the result of translation in atomic detail (i. e. chemical structure).
c. how many different mrna sequences could directly* encode for this same translational product? (* disregard non-coding nucleotides.)
d. how many different single nucleotide mutations could be introduced into the directly encoding dna?
e. how many different translational products would result?
Answers: 1
Biology, 22.06.2019 01:30
Acceleration is a direct result of a.) balanced forces b.) unbalanced forces c.) gravity d.) velocity hurry!
Answers: 1
Biology, 22.06.2019 05:10
Any sound above what db can cause hearing loss in human beings
Answers: 1
Biology, 22.06.2019 10:30
Which is a function of vascular tissue? a. to perform photosynthesis b. to transport water and nutrients c. to absorb minerals and sugar d. to interact with soil fungi
Answers: 1
Biology, 22.06.2019 23:20
Select all the correct answers. which statements fail to meet the requirements of a scientific claim? a) in the final 100 meters of a 10,000-meter race, an athlete's speed is more strongly related to anaerobic efficiency than to aerobic efficiency. b) flowers that reflect the most ultraviolet light are more likely to attract bees and other pollinators than flowers that reflect less ultraviolet light. c) even though evidence indicates that the solar system's planets follow elliptical paths, copernicus's model involving circular orbits is true. d) the evidence supporting newton's laws of motion was accurate in newton's time, but the universe operates differently today.
Answers: 2
Health, 10.12.2020 18:50
Mathematics, 10.12.2020 18:50
Mathematics, 10.12.2020 18:50
Spanish, 10.12.2020 18:50
English, 10.12.2020 18:50
Advanced Placement (AP), 10.12.2020 18:50
History, 10.12.2020 18:50
Mathematics, 10.12.2020 18:50
Mathematics, 10.12.2020 18:50