subject
Biology, 13.11.2019 17:31 jazprincezz7606

True or false kelp are multicellular organisms that live in the ocean.

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 06:30
What are two examples of conduction that we use everyday
Answers: 3
question
Biology, 22.06.2019 08:00
Which of the following is a testable hypotheses?
Answers: 1
question
Biology, 22.06.2019 10:30
Natural selection changes allele frequencies because some survive and reproduce more successfully than others.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
True or false kelp are multicellular organisms that live in the ocean....
Questions
question
Mathematics, 24.11.2020 09:00
question
Biology, 24.11.2020 09:00
question
Mathematics, 24.11.2020 09:00
question
Mathematics, 24.11.2020 09:00
question
Mathematics, 24.11.2020 09:00
Questions on the website: 13722361