Which step begins the process of translation?
a. a ribosome reads the codon sequence at the 5' end of mrna.
b. the ribosome releases the protein and detaches from the mrna.
c. a stop codon indicates the end of the polypeptide.
d. trna connects an amino acid to the ribosome
Answers: 1
Biology, 21.06.2019 16:00
You need to make 500ml of 7h9(+) media with 1x adn and 30ug/ml of the antibiotic kanamycin. your stock solutions are 10x adn and 30mg/ml of kanamycin. the solvent is distilled water. how much of each component will you need to make the desired final solution?
Answers: 2
Biology, 22.06.2019 05:10
Hydrilla (hydrilla verticillata) is an invasive aquatic plant and one of the most serious aquatic pests in florida. hydrilla has already been introduced to hundreds of bodies of water throughout florida, hydrilla is difficult to control because it grows rapidly and survives in many different water depths and conditions. hydrilla • describe how hydrilla affects native plant and animal species. include both a biotic and an abiotic limiting factor. • suggest one biotic and one abiotic recommendation that could slow the spread of hydrilla
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:20
Where is the nictitating membrane found? a. between the eyelid and the eyeball b. between the retina and the optic nerve c. between the outer and middle ear d. in the organ of corti in the middle ear
Answers: 2
Which step begins the process of translation?
a. a ribosome reads the codon sequence at the 5...
a. a ribosome reads the codon sequence at the 5...
Mathematics, 17.10.2019 21:30
History, 17.10.2019 21:30
History, 17.10.2019 21:30
English, 17.10.2019 21:30
History, 17.10.2019 21:30
Social Studies, 17.10.2019 21:30
History, 17.10.2019 21:30
Social Studies, 17.10.2019 21:30
History, 17.10.2019 21:30
Geography, 17.10.2019 21:30
English, 17.10.2019 21:30
History, 17.10.2019 21:30
Chemistry, 17.10.2019 21:30