![subject](/tpl/images/cats/biologiya.png)
Biology, 16.11.2019 06:31 miayadeliss6910
Suppose 64% of a remote mountain village can taste phenylthiocarbamide (ptc) and must, therefore, have at least one copy of the dominant ptc taster allele. if this population conforms to hardy-weinberg expectations for this gene, what percentage of the population must be heterozygous for this trait?
a) 1690
b) 32%
c) 40%
d) 48%
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 13:00
Idont think i'm understand this some one me! before we begin our discussion on evolutionary theory, reflect on your personal philosophical or religious views with regards to evolutionary theory. what is the difference between science and religion?
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
What type of graph presents information about how often certain or traits occur?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 16:00
Which of the following is a true statements about viruses? viruses have no nucleus. viruses are alive. viruses have a cell membrane. all viruses are deadly.
Answers: 1
You know the right answer?
Suppose 64% of a remote mountain village can taste phenylthiocarbamide (ptc) and must, therefore, ha...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 15.01.2021 23:50
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/nemec.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 15.01.2021 23:50
![question](/tpl/images/cats/en.png)
English, 15.01.2021 23:50
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 15.01.2021 23:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/ap.png)
Advanced Placement (AP), 15.01.2021 23:50
![question](/tpl/images/cats/mat.png)
Mathematics, 15.01.2021 23:50
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 15.01.2021 23:50
![question](/tpl/images/cats/mat.png)
Mathematics, 15.01.2021 23:50
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 15.01.2021 23:50
![question](/tpl/images/cats/mat.png)
Mathematics, 15.01.2021 23:50