Protein synthesis and mutation cer practice
what is the type of mutation that has occurred in this sequence and its
significance?
original dna sequence: ctgcacctgactcctgaggag
mutated dna sequence: ctgcacctgactcctgggag
claim:

after a the power stroke, adp is released, but the cross-bridge formed is still in place. atp then binds to myosin, moving the myosin to its high-energy state, releasing the myosin head from the actin active site.

if the hares very faster than they are now, and thus the lynx's hunting success rate drops because it will be harder to catch them, the rate that will change will be the pray-rate. the pray-rate will change because more hares will be able to survive, thus more individuals for reproduction, so the end result will be increasing population of hares.

the predator-rate will remain pretty much the same because there will be more than enough pray, but the hunting success rate is stagnant.

i got you i did it ya know what it is just needing to fill this in for a quick task!