subject
Biology, 18.11.2019 23:31 ugum

Similar to the domain swapping experiments discussed in chapter 19, you create either truncated versions or hybrid versions of proteins containing domains from the eukaryotic activator gal4 and/or the bacterial repressor lexa. the ability of these altered proteins to activate transcription is assayed using a reporter construct engineered by placing either the lexa or gal4 dna-binding site upstream of the lacz gene. which scenario leads to expression of the lacz gene in s. cerevisiae?

(a) a hybrid protein containing the lexa dna-binding domain fused to the gal4-activating domain is tested using a reporter that contains the lexa-binding site upstream of lacz.
(b) a truncated protein made using only the gal4 dna-binding domain is tested using a reporter that contains the lexa binding site upstream of lacz.
(c) a truncated protein made using only the gal4-activating region is tested using a reporter that contains the gal4-binding site upstream of lacz.
(d) a hybrid protein containing the lexa dna-binding domain fused to the gal4-activating region is tested using a reporter that contains the gal4-binding site upstream of lacz.

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 08:30
How does the carbon cycle involve an exchange of carbon
Answers: 2
question
Biology, 22.06.2019 09:00
Which of these transport mechanisms moves glucose from the blood into a cell? active transport diffusion facilitated diffusion osmosis
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 15:00
How are fossils most commonly formed
Answers: 1
You know the right answer?
Similar to the domain swapping experiments discussed in chapter 19, you create either truncated vers...
Questions
question
Computers and Technology, 22.07.2019 02:30
Questions on the website: 13722361