Which has an important role in how species change over time?

a.
mutations

b.
spindle formation

c.
dna replication

d.
cytokinesis

Last week i was assigned a thematic. we have groups of three but the people i was assigned with haven't been in school for days. i would appreciate if anyone can me with my thematic . i highlighted most of the important steps and i circled my thematic topic. in desperate need : ( its due on february 19

Which of the following types of stars is most likely to end up as a supernova? in graph a, the curve peaks at 800 nm, in the red section of the visible light spectrum. in graph b, the curve peaks at 550 nm, in the green section of the visible light spectrum. in graph c, the curve peaks at 450 nm, in the blue section of the visible light spectrum. in graph d, the curve peaks at 300 nm, in the violet section of the visible light spectrum. a b c d

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?