subject
Biology, 26.11.2019 05:31 carlosbs71

You performed a sanger sequencing reaction and obtained the following electropherogram (a computer-generated trace of the intensity of each color's fluorescence). in this figure, a = green, c = purple, g = black, t = red. the height of the peaks is unimportant. the 5' end of the sequence is at the left of the trace.

what is the sequence of the template dna used for this sequencing reaction?

a.

5' tttgctttgtgagcggataacaa 3'

b.

3' tttgctttgtgagcggataacaa 5'

c.

5' aaacgaaacactcgcctattgtt 3'

d.

5’ ttgttatccgctcacaaagcaaa 3’

e.

3' aaacgaaacactcgcctattgtt 5'

can someone with this? i can never get more than 3/5 right:

match the following terms with their descriptions below.

question selected match
used to detect close or exact complementarity to a probe sequence

c.
high stringency

used in identifying a specific mrna from a mixture

a.
northern blot

used to quantitate the initial template concentration of an unknown relative to a standard template of known concentration

b.
template dna

reliant upon dna mismatch repair

d.
site-directed mutagenesis

refers to the sequence of interest within the sample in a pcr reaction

e.
cycle threshold method (ct)

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 15:30
Which list shows the levels of organization of an organism in hierarchical order from left to right, from the smallest to the most complex?
Answers: 3
question
Biology, 22.06.2019 03:30
How can active reading strategies you? o a. they can you get into better physical shape. o b. they can you read fewer science articles. o c. they can you understand what you read. o d. they can you avoid reading altogether.
Answers: 1
question
Biology, 22.06.2019 14:00
The polio virus can cause skeletal muscle paralysis by destroying neuron cell bodies. what area of the spinal cord is destroyed
Answers: 3
question
Biology, 22.06.2019 16:30
How did the club fungi get its name? a. it is named for the club-shaped seeds it produces. b. it is named for the way individual species grow together in small groups called “clubs.” c. it is named for the club-shaped area where it produces spores. d. it is named for the club-like mechanism it uses to kill its prey.
Answers: 2
You know the right answer?
You performed a sanger sequencing reaction and obtained the following electropherogram (a computer-g...
Questions
question
Computers and Technology, 04.10.2019 22:30
Questions on the website: 13722362