Biology, 28.11.2019 03:31 potato1458
First drag pink labels to pink targets to identify the digestive organs. then drag blue labels to blue targets to identify the source of each digestive enzyme or fluid.
Answers: 3
Biology, 22.06.2019 09:40
Which statement is the best summary of the model? a-a series of aerobic and anaerobic reactions take place in cells b- the sun's energy moves through trophic levels in a food chain c-light energy is converted into stored chemical energy plants.d- food molecules are broken down in the cells if living things.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:00
The embryos of a bird, a reptile, and a mammal are similar in appearance. how does comparing the physical appearance of embryos of different species support the theory of evolution? a. it shows that these organisms share a common ancestor. b. it provides evidence that these organisms eat the same foods.c. it shows that these organisms share the same habitat.d. it provides evidence that these organisms suffered a genetic mutation.
Answers: 1
Biology, 22.06.2019 12:30
Describe the relationship between isotonic solutions, equilibrium, and water movement into and out of a cell.
Answers: 1
First drag pink labels to pink targets to identify the digestive organs. then drag blue labels to bl...
Computers and Technology, 26.08.2021 18:10
Mathematics, 26.08.2021 18:10
Mathematics, 26.08.2021 18:10
Mathematics, 26.08.2021 18:10
Mathematics, 26.08.2021 18:10
Mathematics, 26.08.2021 18:10
Mathematics, 26.08.2021 18:10
Mathematics, 26.08.2021 18:10
Mathematics, 26.08.2021 18:10