Which of the following statements about mutations is false? view available hint(s) which of the following statements about mutations is false? an addition mutation results in an added base in the dna sequence. a knock-out mutation results in a total absence of the mutated protein. a deletion mutation results in the loss of a base in the dna sequence. addition and deletion mutations disrupt the primary structure of proteins.

What feature of cell theory is best demonstrated in the image

He did not infringe upon the policy making powers that he felt the constitution gave congress. but the determination of foreign policy became preponderantly a presidential concern. when the french revolution led to a major war between france and england, washington refused to accept entirely the recommendations of either his secretary of state thomas jefferson, who was pro-french, or his secretary of the treasury alexander hamilton, who was pro-british. rather, he insisted upon a neutral course until the united states could grow stronger. which provides the best objective summary of this excerpt? president washington made a good choice when he decided not to accept the recommendations of his advisors and instead insisted that the united states stay neutral during the war between france and england as president, washington believed that the united states should remain neutral in foreign policy even though he had advisors who recommended that he take sides during the war between france and england. washington did not make policy decisions during his presidency because he did not want to interfere with the policy-making powers that the constitution gave congress. washington refused to accept entirely the recommendations of either his secretary of state thomas jefferson, who was pro-french, or his secretary of the treasury alexander hamilton, who was pro-britis

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?