Astudent measured the time required for a protein sample to be completely digested in the presence of an enzyme under different ph levels.
at which ph are all three of the enzymes below the least effective?

a. 2
b. 5
c. 7
d. 10

How are organisms in the domain eukarya different from those in the domain archaea? o a. eukaryotes have a cell wall. o b. eukaryotes have mitochondria. o c. eukaryotes have more than one cell. o d. eukaryotes have dna. submit

Which skeletal system is represented by the shaded portion of the skeleton? spongy skeleton compact skeleton axial skeleton appendicular skeleton

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?