Biology, 16.01.2020 23:31 fayth1760

How many amino acids would be included in the polypeptide encoded by the following mrna s'3 a. 7 b. 8 c. 9 d. 10 e. 16

Answers: 1

Show answers

Answers

8 amino acids would be included in the polypeptide encoded by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA 3'

mRNA CODONS:

mRNA is a type of RNA molecule that transmits genetic information stored in the DNA molecule. mRNA sequence, during the process of translation, is read in a group of three nucleotide bases called CODONS. Each codon encodes an amino acid. According to this question, the following mRNA sequence is given: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA 3'. This sequence consists of 48 nucleotide bases. However, translation begins with a start codon with sequence: AUG. In this sequence, translation starts from AUG until it reaches a stop codon (UGA). There are 24 nucleotide bases until this point, hence, 24/3 = 8 amino acids would be included in the polypeptide encoded by the given mRNA.

Learn more at: link

How many amino acids would be included in the polypeptide encoded by the following mrna s'3 a. 7 b.

Answer from: unkown77

Explanation: During translation, several codons have special functions which they serve. AUG is called the initiation codon, it signals the beginning of polypeptide synthesis and also codes for methionine in the internal positions. UAA, UAG and UGA are called termination codons because they do not code for any known amino acid. They signal the end of a polypeptide synthesis.

Each codon is made up of three nucleotides. The number of codons between the initiation codon UAG and the termination codon UGA in the mRNA is seven, thereby encoding seven amino acids.

See the attached diagram for further illustration.

Answer from: Quest

Answer: the dna polymerase checks for errors in dna to prevent replication mistakes.
i hope this !

Answer from: Quest

label a cell membrane

label b cytoplasm

label c ribosomes

label d dna

the membrane forms the outside of the cell

cytoplasm is the liquid within

ribosomes are the components within that distribute rna

the dna is the genetic make-up

Another question on Biology

Biology, 21.06.2019 15:00

According to the theory of punctuated equilibrium, at what rate does speciation occur? species change depending on the rate of natural selection. after periods of stasis, new species evolve relatively rapidly. species change slowly and eventually form new species. some species change quickly and others change slowly to balance the overall rate.

Answers: 3

Answer

Biology, 21.06.2019 19:50

Which experiment would most likely contain experimental bias

Answers: 1

Answer

Biology, 21.06.2019 20:10

Growth of chest hair, deepening of the voice, and muscle growth are secondary sex characteristics. which most likely affects the development of these traits? testes ovaries prostate gland vulva

Answers: 3

Answer

Biology, 22.06.2019 08:30

What was darwins theory of common decent

Answers: 3

Answer

You know the right answer?

How many amino acids would be included in the polypeptide encoded by the following mrna s'3 a. 7 b....

Questions