subject
Biology, 12.02.2020 20:41 Jasten

In 1925, scientists exploring how lipids are arranged within cell membranes performed a key experiment using red blood cells. Using benzene, they extracted the lipids from a purified sample of red blood cells. Because these cells have no nucleus and no internal membranes, any lipids they obtained were guaranteed to come from the plasma membrane alone The extracted lipids were floated on the surface of a trough filled with water, where they formed a thin film. Using a movable barrier, the researchers then pushed the lipids together until the lipids formed a continuous sheet only one molecule thick The researchers then made an observation that led them to conclude that the plasma membrane is a lipid bilayer. Which of the flowing would have allowed the scientists to come to this conclusion?
Choose one:
The extracted lipids covered half the surface area of the intact red blood cells.
The extracted lipids covered the same surface area as the intact red blood cells.
When pushed together, the extracted lipids dissolved in water.
The extracted lipids covered twice the surface area of the intact red blood cells,

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 15:00
The climate on the leeward side of a mountain differs from that on the windward side mostly in
Answers: 2
question
Biology, 22.06.2019 20:30
Strands of genetic material floating in the nucleus are referred to as
Answers: 1
question
Biology, 22.06.2019 20:50
The genetic code is essentially the same for all organisms. based on this information, one can logically assume which of the following statements to be correct? a. dna was the first genetic material. b. the same codons in different organisms translate into the different amino acids. c. different organisms have different numbers of different types of amino acids. d. a gene from an organism can theoretically be expressed by any other organism. e. all organisms have experienced convergent evolution.
Answers: 3
You know the right answer?
In 1925, scientists exploring how lipids are arranged within cell membranes performed a key experime...
Questions
question
Mathematics, 15.04.2020 15:36
Questions on the website: 13722367