Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh protein in Drosophila melanogaster. Nucleotides that differ from the first sequence are shown by a lowercase letter.

ATGTCTCTCACCAACAAGAACGTC

ATGgCTCTCACCAACAAGAACGTC

ATGTCgCTCACCAACAAGAACGTC

ATGTCTtTgACCAACAAGAACGTC

a. What are the first eight amino acids for each of these four DNA sequences?

b. For each of the four polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism.

c. Synonymous polymorphisms tend to be more common than nonsynonymous ones. Why might that be?