![subject](/tpl/images/cats/biologiya.png)
Biology, 28.02.2020 18:59 oscargonzalez4310
Suppose a mutant strain can survive if substrate 5 is added to the growth medium but it cannot grow if substrates 1, 2, 3, or 4 are added. Which enzyme in the pathway is affected in this mutant?
a. enzyme C
b. enzyme B
c. enzyme E
d. enzyme D
e. enzyme A
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 00:00
You decide that the introduction should also discuss the extremophiles that are referred to as the archaea. these single-cell organisms are considered "extremophiles" due to their ability to survive and reproduce in environmental conditions that would be hostile for most living organisms. archaea species have been isolated from highly acidic sulfur springs, ocean floor thermal vents with temperatures that exceed boiling, and subarctic ice well below freezing. while still considered to be prokaryotic, the archaea have numerous differences that place them apart from the bacteria. choose the characteristics that separate the archaea from other prokaryotic cells. select all that apply. view available hint(s) select all that apply. archaea lack true peptidoglycan in their cell walls. the morphology of the cell is rigid and is geometric in shape, similar to a sphere or cylinder. the cytoplasmic membrane lipids of archaea have branched or ringform hydrocarbon chains. all currently identified and characterized archaea have been linked as the causative agent to an animal or human disease.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:30
Plz ! a scientist wants to produce a cow that makes a particular human protein in it’s milk the desired protein causes blood to clot and can be used to treat hemophilia (a blood clotting disorder). which of the following would be best for the scientist to use? a. genetic crosses. b. cloning. c. selective breeding. d. genetic engineering.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:00
Which of the following types of stars are dim but can have high surface temperatures? giants main sequence stars supergiants dwarfs
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Suppose a mutant strain can survive if substrate 5 is added to the growth medium but it cannot grow...
Questions
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 25.08.2020 21:01
![question](/tpl/images/cats/istoriya.png)
History, 25.08.2020 21:01
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/en.png)
English, 25.08.2020 21:01
![question](/tpl/images/cats/mat.png)
Mathematics, 25.08.2020 21:01
![question](/tpl/images/cats/biologiya.png)
Biology, 25.08.2020 21:01
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 25.08.2020 21:01
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/himiya.png)
Chemistry, 25.08.2020 21:01
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/istoriya.png)
History, 25.08.2020 21:01
![question](/tpl/images/cats/mat.png)
Mathematics, 25.08.2020 21:01
![question](/tpl/images/cats/ekonomika.png)
Business, 25.08.2020 21:01
![question](/tpl/images/cats/pravo.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 25.08.2020 21:01