![subject](/tpl/images/cats/biologiya.png)
Biology, 05.03.2020 22:11 mrwiggles675
It can be desirable to produce eukaryotic proteins in prokaryotes such as E. coli. To do this several DNA sequences must be joined or cloned together. Place the labels in the appropriate position to allow for the expression of the insulin protein in a prokaryotic cell. cDNA is DNA that is synthesized from the mature mRNA from eukaryotic cells using the enzyme reverse transcriptase.
5' end 3' end
1. Poly A signal sequence
2. Genomic clone of insulin
3. Rho terminator
4. -95 CAT box
5. -10 TATA
6. -25 TATA box
7. cDNA of insulin
8. -35 Sequence
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:30
Consider the following reaction: 2h2 + o2 —> 2h2o a) what are the reactants in this reaction? b) what are the products in this reaction? c) how many molecules of oxygen are used in this reaction?
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:30
Which short-term environmental change is most likely to lead to ground shifting, landslides, and the collapse of buildings or roads? forest fires flooding earthquakes
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 11:00
The main ingredient of magma is a pahoehoe. b silca c dissolved gases d obsidian
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
It can be desirable to produce eukaryotic proteins in prokaryotes such as E. coli. To do this severa...
Questions
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/istoriya.png)
History, 06.01.2021 07:30
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 06.01.2021 07:30
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 06.01.2021 07:30
![question](/tpl/images/cats/es.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
English, 06.01.2021 07:30
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 06.01.2021 07:30
![question](/tpl/images/cats/istoriya.png)
History, 06.01.2021 07:30
![question](/tpl/images/cats/mat.png)
Mathematics, 06.01.2021 07:30
![question](/tpl/images/cats/biologiya.png)
Biology, 06.01.2021 07:30
![question](/tpl/images/cats/es.png)
Spanish, 06.01.2021 07:40