![subject](/tpl/images/cats/biologiya.png)
Biology, 17.03.2020 01:18 kraigstlistt
Given that the sequence of nucleotides in a DNA strand will be used to produce an mRNA strand that will then code for a protein, mutations in the DNA can affect the final product. Depending on the severity of the mutation, the protein can range from not being affected to being rendered completely nonfunctional, especially if the reading frame is altered. Which of the following represents a change in reading frame if the template strand of DNA reads as follows?
A) AGCTGGACTTTAGACAAG
B) AGCTGGACTTTAGACAAG
C) AGCTGGACTTGAGTGAACAAG
D) AGCTGGACTATAGACAAG
E) AGCUGGACUUUAGACAAG
F) AGCTGCGACTTTAGACAAG
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 23:10
Depending on the organism the number of in a cell may change
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:40
Migration is a. the movement of organisms from a native location to a foreign location b. the movement of organisms from a foreign location to a native location the movement of organisms from their water supply to their food supply d. the seasonal movement of organisms between locations c. select the best answer from above
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:00
Select the correct answer from each drop-down menu. which phase of mitotic division is the highlighted cell undergoing? the cell is undergoing , which is the stage before .
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 22:30
Skulls of homo sapiens were found during an excavation. the skulls were preserved because the bodies were frozen. so, these fossils are ( 1 ) fossils. ( 1 ) a. mineralized b. mold c. original-tissue
Answers: 1
You know the right answer?
Given that the sequence of nucleotides in a DNA strand will be used to produce an mRNA strand that w...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 02.01.2021 16:50
![question](/tpl/images/cats/biologiya.png)
Biology, 02.01.2021 16:50
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/geografiya.png)
Geography, 02.01.2021 16:50
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 02.01.2021 16:50
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/en.png)
English, 02.01.2021 16:50
![question](/tpl/images/cats/fizika.png)
Physics, 02.01.2021 16:50
![question](/tpl/images/cats/mat.png)
Mathematics, 02.01.2021 16:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/fizika.png)
Physics, 02.01.2021 16:50