![subject](/tpl/images/cats/biologiya.png)
A Drosophila fruit fly cell with 2N = 8 chromosomes—two of each kind—is called a cell. a. haploidb. diploidOneof eachis located on each chromosome. a. gene, alleleb. gene, genec. allele, gened. allele, allele Drosophila fruit flies produce gametes with one of each kind of chromosome. These gametes are calledcells. a. diploidb. haploid These cells containchromosomes. a. 4Nb. 2Nc. Nd. 1/2 N
![ansver](/tpl/images/cats/User.png)
Answers: 2
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 16:30
Which organism is the producer in this food web? 7th grade question. a) arthropods b) birds c) fungi d) plants
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 20:00
Use the drop-down menu to match the following definitions to the corresponding terms. the total variety of organisms that live in the biosphere a group of organisms that breed and produce offspring that can breed all of the biotic and abiotic factors in an area
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
You know the right answer?
A Drosophila fruit fly cell with 2N = 8 chromosomes—two of each kind—is called a cell. a. haploidb....
Questions
![question](/tpl/images/cats/istoriya.png)
History, 09.10.2019 02:10
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
History, 09.10.2019 02:10
![question](/tpl/images/cats/mat.png)
Mathematics, 09.10.2019 02:10
![question](/tpl/images/cats/istoriya.png)
History, 09.10.2019 02:10
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 09.10.2019 02:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 09.10.2019 02:10
![question](/tpl/images/cats/health.png)
Health, 09.10.2019 02:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 09.10.2019 02:10
![question](/tpl/images/cats/istoriya.png)
History, 09.10.2019 02:10
![question](/tpl/images/cats/mat.png)
Mathematics, 09.10.2019 02:20
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
English, 09.10.2019 02:20