Agroup of scientists are studying the effects of different fertilizers on the growth of pea plants. they began their study with 10 pea plants. they gave each plant a different type of fertilizer and tracked their growth over a period of 2 months. what’s the independent variable in this experiment?
a. the growth of the plants
b. the type of fertilizer
c. the amount of fertilizer
d. the plants
Answers: 1
Biology, 21.06.2019 18:40
In dna, only the_ varies from one nucleotide to another. base phosphate sugar amino acid
Answers: 2
Biology, 22.06.2019 01:30
Based on the law of dominance, we would expect percent of the offspring from this cross to have large teeth.
Answers: 2
Biology, 22.06.2019 10:40
Which of the following is a period in the paleozoic era? devonian cambrian permian all of the above
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Agroup of scientists are studying the effects of different fertilizers on the growth of pea plants....
Mathematics, 20.02.2020 02:06
Mathematics, 20.02.2020 02:06
Mathematics, 20.02.2020 02:06