The telomerase enzyme in human cells … Group of answer choices has an RNA component. extends the telomeres by its RNA polymerase activity. polymerizes the telomeric DNA sequences without using any template. removes telomeric DNA from the ends of the chromosomes. creates the ""end-replication"" problem.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

How do all types of diffusion/passive transport actually ‘work’ without using even the smallest amount of cellular energy?

Ascientist wanted to formulate a pill to attack a specific type of bacteria that infects the throat. which biological component would be best to use as a model for the pill's function? bacteriocytes phagocytes complement antibodies