subject
Biology, 29.03.2020 21:45 famouzgal

After meiosis has occurred, what cells are identical.

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 18:50
The eruption of a nearby volcano causes a prairie ecosystem to receive a lot less sunlight.which of these is the most likely effect on the ecosystem? a-an increase in biodiversity. b-an increase in immigration to the area. c-a decrease in available water. d-a decrease in plant growth.
Answers: 2
question
Biology, 22.06.2019 00:00
Twind is considered to be an abiotic factor because it.?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:00
Refer to the family pedigree shown here. in generation i, one parent is affected by the gene mutation and one parent isn't. in generation ii, all three children are affected by the gene mutation. what can you conclude about this gene mutation? a. all children born in future generations will be affected by this disorder. b. this gene mutation is a dominant disorder. c. this gene mutation is a recessive disorder. d. the generation i mother is a carrier of this gene mutation.
Answers: 2
You know the right answer?
After meiosis has occurred, what cells are identical....
Questions
question
Mathematics, 20.11.2019 09:31
question
Mathematics, 20.11.2019 09:31
question
Social Studies, 20.11.2019 09:31
question
Mathematics, 20.11.2019 09:31
Questions on the website: 13722367