Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

Arrange the following in the correct sequence, from earliest to most recent, in which these plant traits originated. 1. sporophyte dominance, gametophyte independence 2. sporophyte dominance, gametophyte dependence 3. gametophyte dominance, sporophyte dependence a) 1 → 2 → 3 b) 2 → 3 → 1 c) 2 → 1 → 3 d) 3 → 2 → 1 e) 3 → 1 → 2

~~16. while watching a special on animals, brianna discovers that hares tend to lose heat through their ears. based on this and what is known about surface-to-volume ratios, propose an explanation as to why hares that live in hot climates (such as the desert) have large, extended ears

Keeping in mind the life cycle of bacteriophages, consider the following problem: during the reproductive cycle of a temperate bacteriophage, the viral dna inserts into the bacterial chromosome where the resultant prophage behaves much like a trojan horse. it can remain quiescent, or it can become lytic and initiate a burst of progeny viruses. several operons maintain the prophage state by interacting with a repressor that keeps the lytic cycle in check. insults (ultraviolet light, for example) to the bacterial cell lead to a partial breakdown of the repressor, which in turn causes the production of enzymes involved in the lytic cycle. as stated in this simple form, would you consider this system of regulation to be operating under positive or negative control?