![subject](/tpl/images/cats/biologiya.png)
Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?
a. Normal gene: ATGGCCGGCCCGAAAGAGACC
b. Mutated gene: ATGGCCGGCACCGAAAGAGACC
c. Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr
d. Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 19:30
What kind of seafood would you expect to have the highest levels of mercury and why? kelp, because they use the sun to photosynthesize on the bottom trophic level. oysters, because they filter feed on plankton on a lower trophic level. small fish, because they eat plankton on a higher trophic level. sharks, because they feed on organisms on a higher trophic level.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 21:30
Before the can be observed by using a transmission electron microscope, cells are sliced into very thin sections. what disadvantage does this procedure present in the study of cellular parts
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:00
Nerve cells are specialized to respond to stimulitrue or false?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:00
What happens when water’s salinity increases? mass decreases. freezing point decreases. buoyancy of objects decreases. the amount of dissolved minerals decreases.
Answers: 2
You know the right answer?
Based on the gene and protein sequences that follow, what type of mutation has occurred and what is...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 14.06.2021 21:50
![question](/tpl/images/cats/mat.png)
Mathematics, 14.06.2021 21:50
![question](/tpl/images/cats/en.png)
English, 14.06.2021 21:50
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.06.2021 21:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.06.2021 21:50
![question](/tpl/images/cats/mat.png)
Mathematics, 14.06.2021 21:50
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.06.2021 21:50
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/himiya.png)
Chemistry, 14.06.2021 21:50
![question](/tpl/images/cats/mat.png)
Mathematics, 14.06.2021 21:50
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/es.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.06.2021 21:50