Write the tRNA sequence for the given strand of mRNA
AGGUCAUGCAUGGGCAUGCAU

What kind of bond is created by the attraction between atomic particles of opposite charge? ionic bond hydrogen bond covalent bond nuclear bond

Suppose that on a small island off the coast of scotland, 32 percent of the population has blue eyes, which means that these individuals must be homozygous for the blue eye color gene (bb). the only other eye color found on the island is brown, and individuals that are homozygous for the brown eye color gene (bb) or heterozygous (bb) will have brown eyes because brown is the dominant gene. assume this population is in hardy-weinberg equilibrium. if 100 babies are born next year, how many of these would you expect to have brown eyes and be heterozygous? a. 58 b. 49 c. 29 d. 43

Homo heidelbergensis was a tall, muscular hunter, who used both tools and weapons. because h. heidelbergensis was not a gatherer/forager, but ate a varied diet including meat and fish, we would expect to see what anatomical changes?