![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:50
Factors that can increase mutation rates a. high temps b. low temps c. food additives d. uv rays
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:30
Gregor mendel is best known for his work with pea plants and for uncover many of the mysteries of genetics. one of his major findings stated that there were specific, physical units of inheritance that are transmitted during reproduction. what is the the name given to these units of inheritance which can be found on chromosomes? a) centromeres b) cytoplasm c) genes d) nucleotides
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:30
Antoine manages a number of apartment buildings that use natural gas for heating, cooking, and laundry. the scatter plot shows the correlation between the outside air temperature and antoine's natural gas bill. which type of correlation does the plot illustrate?
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Marine animals are harmed by toxic chemicals and by...
Questions
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 05.11.2020 23:00
![question](/tpl/images/cats/mat.png)
Mathematics, 05.11.2020 23:00
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/es.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 05.11.2020 23:00
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 05.11.2020 23:00
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 05.11.2020 23:00
![question](/tpl/images/cats/en.png)
English, 05.11.2020 23:00
![question](/tpl/images/cats/mat.png)
Mathematics, 05.11.2020 23:00
![question](/tpl/images/cats/mat.png)
Mathematics, 05.11.2020 23:00
![question](/tpl/images/cats/himiya.png)
Chemistry, 05.11.2020 23:00
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 05.11.2020 23:00
![question](/tpl/images/cats/himiya.png)
Chemistry, 05.11.2020 23:00
![question](/tpl/images/cats/istoriya.png)
History, 05.11.2020 23:00
![question](/tpl/images/cats/mir.png)
World Languages, 05.11.2020 23:00