The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.

Which statement correctly describes other ways in which nebulae and stars are different? a. a star always has a higher density than a nebula. b. stars can form inside a nebula but a nebula can never be produced by any star. c. stars can never form inside a nebula but a nebula can be produced by any star. d. a nebula always has a higher density than a star. reset submit

Astudent poured a solution of bromothymol blue indicator into three test tubes. then he placed an aquatic plant in two of the test tubes, as shown below. he placed a stopper on each test tube and placed them all in the dark for 24 hours. bromothymol blue turns from blue to yellow in the presence of co2

Select the correct answer. which statement applies only to the axial skeleton, not the appendicular skeleton? a. it contains a pivot joint. b. it has muscles attached that work in pairs. c. it contains red bone marrow. d. it possesses fossa for bone articulation. e. it protects the heart and lungs.