Write the complementary sequence to following DNA strand: AATTGCGATCGCTCGTACCGG

Parasitism could be considered a form of which of these types of relationships? -mutualism -commensalism -predator-prey -mimicry

Which of the following describes a boom period? a. as one population increases, another population decreases. b. as one population increases, the other population also increases. c. as one population decreases, another population increases. d. as one population decreases, another population also decreases

Which kingdom includes some organisms that have no nucleus and can live in an environment with an extremely high salt content