Which of the following are characteristics of Ascomycota? Check all that apply.

a. flagellated spores

b. spores produced in the ascus

c. lack reproduction phase

d. important in the food industry

e. important in the digestion of animals

f. can cause disease in plants

g. can cause disease in animals

Cattle with brown fur and cattle with white fur will produce a reddish roan calf . when examined closely, the calf show about an even number of brown hairs and white hairs that give a reddish appearance when viewed from far away. the fact that both the brown fur allele and the white fur allele are expressed equally in the offspring is an example of

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Everything in the universe originated from a single point. how was it possible for everything in the universe to have occupied a single point in space?