Biology, 10.04.2020 23:47 negativechill
Identify the choice that best completes the statement or answers the question. Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below. AUGCCACAGGUUCAUCCGAA… To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?a. Calculate the frequencies of each letter.
b. Count the number of letters in the list.
c. Separate the list into three-letter "words."
d. Separate the list into two-, three- and four-letter "words."
Answers: 2
Another question on Biology
Biology, 22.06.2019 10:30
Which of the following statements is accurate about evolution? question 10 options: natural selection only eliminates odd individuals. evolution means that a population never has changes in its genetic frequencies. mutations are always harmful. evolution means that a population undergoes changes in its gene frequencies over time.
Answers: 1
Biology, 22.06.2019 13:10
Match the correct terms to their descriptions a system in which only energy but not matter is exchanged frozen water in snow part of geosphere that includes only soil a thin layer between the troposphere and the stratosphere cryosphere tropopause closed system pedosphere
Answers: 2
Biology, 22.06.2019 16:30
Genetic orders can result when sister chromatids fail to separate properly during which phase is this problem most likely to occur
Answers: 1
You know the right answer?
Identify the choice that best completes the statement or answers the question. Robert is studying a...
Questions
History, 10.06.2020 04:57
Biology, 10.06.2020 04:57
Computers and Technology, 10.06.2020 04:57
Mathematics, 10.06.2020 04:57
Mathematics, 10.06.2020 04:57
Mathematics, 10.06.2020 04:57
History, 10.06.2020 04:57
Mathematics, 10.06.2020 04:57
