The middle of an mRNA molecule contains the nucleotide
sequence shown here. Much more of the mRNA is translated.
Assume that the sequence is translated from left to right.
AUUUAACUGUUCUGUCUAGAG
Construct an Explanation Based only on the information provided, why could the mRNA
section be translated into three different sets of amino acids, instead of just one set?

Based on the data in your tables, did the light-colored moths have a higher or lower survival rate after the industrial revolution?

Neelaredoxin is a 15-kda protein that is a gene product common in anaerobic prokaryotes. it has superoxide-scavenging activity, and it is constitutively expressed. in addition, its expression is not further induced during its exposure to o2 or h2o2 (silva, g., et al. 2001. j. bacteriol. 183: 4413–4420). which of the following statements best describes neelaredoxin synthesis? a-neelaredoxin is produced at all times; levels are constant even when exposed to o2 or h2o2.b-neelaredoxin is produced at all times; exposure to o2 or h2o2 increases expression.c-neelaredoxin is produced at all times; exposure to o2 or h2o2 decreases or prevents expression.d-neelaredoxin is only produced when there is exposure to o2 or h2o2.

Diagram of the evolution of land plants?