PLEASE HELP (WORTH 50 POINTS)

The middle of an mRNA molecule contains the nucleotide
sequence shown here. Much more of the mRNA is translated.
Assume that the sequence is translated from left to right.
AUUUAACUGUUCUGUCUAGAG
Construct an Explanation Based only on the information provided, why could the mRNA
section be translated into three different sets of amino acids, instead of just one set?

The seaport that is near caracas has which type of climate?

The fish shown above is a tarpon. it is a fast-swimming and powerful open-water fish. its closest relatives, oddly, are burrow-dwelling conger eels that stay on the bottom. both eels and tarpon developed from snake-like larvae that float in the plankton during the first stages of life. once they mature, tarpon and eels are not found near one another in the ocean. the tarpon and the eel illustrate all of the following except

Which set of terms best describes a community of miners who live out in the countryside of west virginia and use specialized geological equipment to analyze the composition of rock?